# University of Colorado Boulder 1002176609

ConfigurationID: 4315737 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 61 shipping: Amb...

**Recipient:** Sigma-Aldrich Inc

**Award Amount:** $13.42
**Ceiling:** $13.42

**Awarded:** August 14, 2025

**Identifier:** 1002176609

The University of Colorado Boulder, a public college or university in Colorado, awarded Sigma-Aldrich Inc a contract on August 14, 2025, for the purchase of DNA oligos in tubes with detailed product specifications. The total obligated amount is $13.42. This is a single-item purchase awarded directly without mention of a multi-year or blanket arrangement.

### Description

ConfigurationID: 4315737 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 61 shipping: Ambient sequence: CAGCTCCTCGCCCTTGCTCACTACTGCCGCAGCGGCATTCGTTGGGGGTCGATGGTTTTGC scale: 0.0500 UMO name: mVenus Up3 R purification: DESALT tu