Award
University of Colorado Boulder 1002175226
ConfigurationID: 4303457 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 58 shipping: Amb...
Recipient
Sigma-Aldrich Inc
Award Amount
$18.02
Ceiling
$18.02
Awarded
August 12, 2025
Identifier
1002175226
The University of Colorado Boulder, a public college or university located in Colorado, issued a single-transaction purchase order on August 12, 2025, to Sigma-Aldrich Inc for DNA oligos used in laboratory research. The order includes two DNA oligo products with base counts of 58 and 48, both supplied in tubes and purified with DESALT. The total awarded amount is $18.02 under a contract, with two line items at unit prices of $9.86 and $8.16 respectively. The purchase appears to be a one-time procurement for scientific research supplies, not a multi-year contract.
Description
ConfigurationID: 4303457 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 58 shipping: Ambient sequence: AGATGCTACTCTGCCATGGTTATTTATCGTCATCATCCTTATAATCAATATCATGGTC scale: 0.0250 UMO name: Tweek C mVenus R2 purification: DESALT; ConfigurationID: 4303456 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 48 shipping: Ambient sequence: CAGCAAAACCATCGACCCCCAACGAATGCCGCTGCGGCAGTAGTGAGC scale: 0.0250 UMO name: Tweek C mVenus F2 purification: DESALT tubes: 1 p