Iowa State University of Science and Technology PO-1339102

Name:KAP3977AUL1-attB1-gBlocks Sequence:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATGATTTCACAGGATTGTTAGCGAGAGACTTCGGATTGAAAC...

This purchase order involves Iowa State University of Science and Technology, a public college or university, issuing a contract to Integrated DNA Technologies (CYBUY) for the procurement of specific synthetic DNA sequences, including the KAP3977AUL1-attB1-gBlocks. The order was placed on June 18, 2026, with an obligated and awarded amount of $310.00. The contract appears to be a single-transaction order for one unit of the specified product, with no indication of a multi-year or blanket arrangement. The purchase is categorized under the procurement of scientific research materials, and the award is located in Ames, Iowa, within Polk County, United States.

Description

Name:KAP3977AUL1-attB1-gBlocks Sequence:GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATGATTTCACAGGATTGTTAGCGAGAGACTTCGGATTGAAACCTCAGGGAAAATCAGCTCCCATGGCGTCTCAATCGAACTCTTCTGCCGCTGATTTCAACACTTTCGCTTCTTCTTATAGCTTCGCCACCGCCGCCGGTAAAAAGTCCGATTCTTTGCCGGTGTTTGACGATCCTG