Award

Iowa State University of Science and Technology PO-1336609

Name:Combined_FPV_Positive_Control_v3 Sequence:ACGTTACGCGTATGCCGTAATACGAGCGCGAGCATTTTTGGACTACCGTAGCGTACGATCGATGCTAGCT...

Recipient

INTEGRATED DNA TECHNOLOGIES (CYBUY)

Award Amount

$179.00

Ceiling

$179.00

Awarded

June 01, 2026

Identifier

PO-1336609

Iowa State University of Science and Technology, a public college or university in Iowa, issued a purchase order (PO-1336609) on June 1, 2026, to Integrated DNA Technologies (CYBUY) for various DNA oligos and related reagents totaling $179.0. The order includes multiple DNA sequences, oligos, and a TE solution, with detailed specifications and standard desalting purification. The procurement appears to be a single-transaction order for laboratory research supplies, with no indication of a multi-year or blanket arrangement. The award is categorized under NAICS code 411056 (Research and Development in Biotechnology). The primary contact details are not provided. The location of the award is in Ames, Iowa, within Story County. Likely competitors for similar awards include companies specializing in DNA oligos and molecular biology reagents, such as Thermo Fisher Scientific, Sigma-Aldrich, and Bio-Rad.

Description

Name:Combined_FPV_Positive_Control_v3 Sequence:ACGTTACGCGTATGCCGTAATACGAGCGCGAGCATTTTTGGACTACCGTAGCGTACGATCGATGCTAGCTAGTCGATCGTAGCTAGCATCGACACCAGGAGAAAAGCTGCAATCGTAGTGTCCTGTAGTTCCTATACCGATCGTAGCTAGCATCGATGCGTACGTAGCTAGCTACGATCGTAGCATGCGAAGAGGAGACCTTCGG; Name:Forward_FcaPV-2 Sequence:TAC GAG CGC GAG CAT TTT TG Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; Name:Reverse_FcaPV-2 Sequence:TGC AGC TTT TCT CCT GGT GT Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; Name:Forward_JMPF Sequence:GTG TCC TGT AGT TCC TAT AC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; Name:Reverse_JMPR Sequence:GTG CCG AAG GTC TCC TCT TC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; Name:Forward_MY09/11 Sequence:GCM CAG GGW CAT AAY AAT GG Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; Name:Reverse_MY09/11 Sequence:CGT CCM ARR GGA WAC TGA TC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; Name:Forward_FAP59/64 Sequence:TAA CWG T/ideoxyI/G G/ideoxyI/C AYC CWT ATT Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:21 Notes:; Name:Reverse_FAP59/64 Sequence:CCW ATA TCW VHC AT/ideoxyI/ TC/ideoxyI/ CCA TC Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:23 Notes:; Name:Forward_Fel_ACTB Sequence:CAA CCG TGA GAA GAT GAC TCA GA Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:23 Notes:; Name:Reverse_Fel_ACTB Sequence:CCC AGA GTC CAT GAC AAT AAC A Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:22 Notes:; Name:Forward_PCCP Sequence:ACG TTA CGC GTA TGC CGT AA Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; Name:Reverse__PCCP Sequence:TGT CCA AGA TCG TGC TCG AA Product:25 nmole DNA Oligo Purification:Standard Desalting Bases:20 Notes:; 300 mL IDTE pH 7.5 (1X TE Solution)