University of Colorado Boulder 1002176379

ConfigurationID: 4313197 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Amb...

On August 14, 2025, the University of Colorado Boulder, a public college or university, issued a single-transaction purchase order to Sigma-Aldrich Inc for DNA oligos in tubes, with a total obligated amount of $16.32. The award includes multiple DNA oligos with specific configurations and sequences, supplied in tubes, under a contract category. The award is likely part of a procurement for molecular biology reagents, possibly for research purposes, with the contract deemed a one-time purchase order without specified end dates. The vendor, Sigma-Aldrich Inc, is identified as the awardee, and the purchase was made in Boulder, Colorado, within the US jurisdiction.

Description

ConfigurationID: 4313197 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: AAACGACCTAGCATGCTTTAAGAT scale: 0.0250 UMO name: gRNA 3HMA C tweek rescue R purification: DESALT tubes: 1 packageType: TUB; ConfigurationID: 4313196 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: GTCGATCTTAAAGCATGCTAGGTC scale: 0.0250 UMO name: gRNA 3HMA C tweek rescue F purification: DESALT tubes: 1 packageType: TUB; ConfigurationID: 4313194 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: GTCGCCTCAAACACGAACCTGACT scale: 0.0250 UMO name: gRNA 5HMA C tweek rescue F purification: DESALT tubes: 1 packageType: TUB; ConfigurationID: 4313195 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: AAACAGTCAGGTTCGTGTTTGAGG scale: 0.0250 UMO name: gRNA 5HMA C tweek rescue R purification: DESALT tubes: 1 packageType: TUB