Iowa State University of Science and Technology PO-1337836

Name:P6-1V2 Sequence:GTTTGGTGTTACTTCTGCAGGGTACCATGAAAAGGACGGCGGACGGGAGCGAATTTGAGTCACCTAAGAAAAAGCGGAAGGTGGACAAAAAGTATA...

Iowa State University of Science and Technology, a public college or university in Iowa, issued a purchase order on June 9, 2026, to Integrated DNA Technologies (CYBUY) for two DNA sequence oligonucleotides, with a total obligated amount of $976. The order includes two line items with specific sequences, each ordered in a quantity of one. The purchase appears to be a single-transaction procurement for molecular biology reagents, with no indication of a multi-year or blanket arrangement. The award is categorized under contract acquisition, and the procurement was managed by the university's relevant department. The award involves two products with NAICS code 41105600, which corresponds to the industry of biological product manufacturing. The contact information for the procurement is not provided. The location of the award is at Iowa State University in Ames, Iowa, within the county of Story. Likely competitors for similar awards include other biotech and molecular biology reagent suppliers such as Thermo Fisher Scientific, Sigma-Aldrich, and Bio-Rad Laboratories.

Description

Name:P6-1V2 Sequence:GTTTGGTGTTACTTCTGCAGGGTACCATGAAAAGGACGGCGGACGGGAGCGAATTTGAGTCACCTAAGAAAAAGCGGAAGGTGGACAAAAAGTATAGCATCGGCCTCGATATTGGGACAAACTCTGTGGGCTGGGCGGTAATTACCGACGAGTACAAGGTGCCTAGTAAGAAATTTAAAGTGCTCGGAAACACTGACAGGCACTCTATAAAGAAGAACCTGATCGGGGCAC; Name:P6-3V2 Sequence:CTTCACCCTGACGAACCTCGGCGCCCCTGCTGCTTTCAAGTACTTCGACACAACTATCGATCGCAAGAGGTACACAAGCACTAAGGAGGTCCTGGACGCGACCCTCATCCACCAGTCGATCACCGGCCTCTACGAGACGCGCATCGACCTGTCTCAGCTCGGCGGCGACTCAGGCGGCTCATCTGGCGGGTCAAAGCGCACAGCCGACGGCTCTGAGTTCGAGAGCCCTAA