# University of Colorado Boulder 1002175272

ConfigurationID: 4311194 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 25 shipping: Amb...

**Recipient:** Sigma-Aldrich Inc

**Award Amount:** $8.33
**Ceiling:** $8.33

**Awarded:** August 12, 2025

**Identifier:** 1002175272

The University of Colorado Boulder, a public college or university in Colorado, Colorado, USA, awarded a contract on August 12, 2025, to Sigma-Aldrich Inc for the purchase of DNA oligos in tubes, with an award amount of $8.33. The contract includes two items: one with 25 base oligos and one with 24 base oligos, both shipped ambient. The award is a single transaction procurement for laboratory research reagents. No special contract requirements are noted.

### Description

ConfigurationID: 4311194 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 25 shipping: Ambient sequence: CAGATCGGATTTGTACGACACGCTG scale: 0.0250 UMO name: MS Mut Seq Check F purification: DESALT tubes: 1 packageType: TUBE melti; ConfigurationID: 4311195 Product Number: VC00021 Product Description: DNA Oligos in Tubes baseCount: 24 shipping: Ambient sequence: CCACTTGGTCGGGTAGTGTATGCG scale: 0.0250 UMO name: MS Mut Seq Check R purification: DESALT tubes: 1 packageType: TUBE meltin